TypeScript - JavaScript's Superset FrescoPlay MCQs Answers
Quiz on TypeScript Grammar
Q1.Static type checking is done at ________.
a) Run time
b) Compilation time
Ans:- 2)Compilation time
Q2.Generics allows accepting arguments of _________.
a) Only one type
b) None of the options
c) Different types
Ans:- 3)Different types
Q3.Annotations can be implemented as __________.
a) length: number
b) length=12
c) static length=12
d) var lengthC='1'
Ans:- 1)length: number
Q4.Which type is assigned to variables with null type?
a) string
b) None of the options
c) boolean
d) any
Ans:- 2)None of the options
Q5.Type Annotations allow us to _______.
a) Cast a reference of a base class to one of its derived classes
b) Record the intended contract of the function or variable
c) Cast to a supertype
d) Reassign the type of data
Ans:- 2)Record the intended contract of the function or variable
Q6.During run time, _______ checking is done.
a) Dynamic Type
b) Static Type
Ans:- 1)Dynamic Type
Q7.A type system is a set of ________.
a) Predefined Functions
b) Data
c) Rules
d) Variables
Ans:- 3)Rules
Quiz on Data Types
Q1.Generics is a/an _______.
a) Class
b) Object
c) Template
d) Functions
Ans:- 3)Template
Q2.Which of the following is the right way of defining enum?
a) enum Enum {}
b) const enum DNA {}
c) declare enum Enum {}
d) All the options
Ans:- 4)All the options
Quiz on Object Oriented Way of Approach
Q1.The following are correct ways of defining variables in TypeScript, except _________.
a) var NumberOfDNA=10231
b) var DNA:string
c) var DNA:string= "CGATAATCGGGGAATTTCAG"
d) var 10231
Ans:- 4)var 10231
Q2.Inheritance is implemented by using the ________ keyword.
a) implements
b) extends
c) namespace
d) None of the options
Ans:- 2)extends
Q3." var jarvis = function (x: number, y?: number): number {} " showcases _________.
a) Defining Parameter
b) Both the options
c) Type annotation
Ans:- 2)Both the options
Q4.Syntax for a decorator is _________.
a) @symbol
b) ?symbol{}
c) *(symbol)
d) #symbol
Ans:- 1)@symbol
Q5.Which of the options is used appropriately in JavaScript code?
a) function reverse(s: string) : string;
b) function reverse (s: String) : String;
Ans:- 1)function reverse(s: string) : string;
Q6.value && typeof value == "DataType" is used for _________.
a) Overloading
b) Type annotation
c) Overriding
d) Inheritance
Ans:- 1)Overloading
Q7.Which of the two is used appropriately in JavaScript code:
a) function reverse(s: string) : string;
b) function reverse (s: String) : String;
Ans:- 1)function reverse(s: string) : string;
Quiz on Introduction to TypeScript
Q1.We can rename a .js file to .ts file generally.
a) False
b) True
Ans:- 2)True
Q2.TypeScript is a __________.
a) New version of JavaScript
b) Compiler
c) Dynamically type-checked language
d) Super-set of JavaScript
Ans:- 4)Super-set of JavaScript
Q3.A JavaScript file cannot be renamed to a TypeScript file.
a) False
b) True
Ans:- 1)False
Q4.The value of TypeScript is writing _________.
a) Safer code
b) Less code
Ans:- 1)Safer code
Q5.A JavaScript file cannot be renamed to a TypeScript file.
a) False
b) True
Ans:- 1)False
Q6.Typescript compiler tsc converts code to _________.
a) Assembly Language
b) JavaScript
c) Machine Language
d) AngularJS
Ans:- 2)JavaScript
Q7.TypeScript was made public by __________.
a) Sun
b) Microsoft
c) Oracle
d) ECMA
Ans:- 2)Microsoft
Q8.TypeScript is __________.
a) Functional
b) Object Oriented
c) Symbolic
d) Procedural
Ans:- 2)Object Oriented
Quiz on Inheritance & Polymorphism
Q1.Which keyword is used for Inheritance in TypeScript?
a) follows
b) extends
c) defines
d) implements
Ans:- 2)extends
Q2.Which keyword is used to access base class properties?
a) super
b) extends
c) base
d) implements
Ans:- 1)super
Q3.TypeScript uses prototypical inheritance instead of classical inheritance.
a) True
b) False
Ans:- 2)False
Q4.Which of the following is/are inherited from base class?
a) method
b) Both the options
c) variables
Ans:- 2)Both the options
Q5.The code snippet " if (value && typeof value == "string") {}; is used for ______________.
a) Parameterising
b) Inheritance add-on
c) Overriding
d) Overloading
Ans:- 4)Overloading
TypeScript Final Assessment
Q1.Accessing a class of a module from outside is impossible in TypeScript.
a) False
b) True
Ans:- 1)False
Q2.How can we access a class of module from outside?
a) namespace classToBeExported{}
b) It is not possible in TypeScript due to safety concerns
c) By using implements
d) By using export
Ans:- 4)By using export
Q3.How can we access a class from a module from outside?
a) By using import
b) By using export
c) By using module
d) By using namespace
Ans:- 2)By using export
Q4.Why are optional parameters added?
a) To assure that value is always assigned to the variable
b) To avoid confusion
c) To avoid assigning value for parameterised variable
d) To add more than three parameters
Ans:- 4)To add more than three parameters
Q5.What is the form associated with @expression?
a) None of the options
b) Constructors
c) Module initialisation
d) Decorators
Ans:- 4)Decorators
Q6.The following types are supported by TypeScript, except ______.
a) boolean
b) enum
c) string
d) integer
Ans:- 4)integer
Q7.Compiled .js of .ts containing class will also have class.
a) False
b) True
Ans:- 1)False
Q8.What does " function f(l: number, w: number){} " demonstrate?
a) Type annotation
b) Reassigning data type
c) Namespace
d) Modules
Ans:- 1)Type annotation
Q9.Contextual typing in TypeScript is a form of ___________.
a) It does not exist
b) Type Inference
c) Type Checking
d) Inheritence
Ans:- 2)Type Inference
Q10._________ in the command line enables experimental support for decorators.
a) "target": "ES5"
b) "experimentalDecorators": true
c) "compilerOptions": {}
d) "tsc --target ES5 --experimentalDecorators"
Ans:- 4)"tsc --target ES5 --experimentalDecorators"
Q11.During compilation time, ________ checking is done.
a) Static type
b) Dynamic type
Ans:- 1)Static type
Q12.Decorators provide a way for ________________.
a) None of the options
b) Annotation
c) Meta-programming syntax
d) Both the options
Ans:- 4)Both the options
Q13.At most, how many decorators can be applied to a declaration?
a) Only one per declaration
b) Three
c) Multiple
d) Only one in a single line
Ans:- 2)Three
Q14.Type System is a _____________.
a) Compiler
b) Scripting Language
c) Programming Language
d) Set of rules
Ans:- 4)Set of rules
Q15.any type is assigned to the variable in case of _____________________.
a) not initialising nor defining the type of variable
b) not initialising the variable
c) "Zero" or "0" assigned to the variable
d) null value assigned to the variable
Ans:- 1)not initialising nor defining the type of variable
Q16.Dynamic type checking is done at __________.
a) Compilation time
b) Run time
Ans:- 2)Run time
Q17.Which of the following demonstrates function overloading, if possible, in TypeScript?
a) if (value && typeof value == "number"){}
b) get len():string
c) var f = 0;
d) var a = function (n1: number, n3?: number) : number{}
Ans:- 1)if (value && typeof value == "number"){}
Q18.Enum organizes a _______.
a) Set of un-related values
b) Set of related values
Ans:- 2)Set of related values
Q19.What is true about Mixins in TypeScript?
a) They are mixed together to form a new class
b) They are partial classes
c) All the options
d) Each class is focused on a particular activity
Ans:- 3)All the options
Q20.Which of the options is used appropriately in JavaScript code?
a) function reverse(s: string) : string;
b) function reverse (s: String) : String;
Ans:- 2)function reverse (s: String) : String;
21.The interface of TypeScript is usually converted to JavaScript.
a) False
b) True
Ans:- 1)False
Q22.TypeScript provides access to private members through ___________.
a) finally block
b) get and set
c) try and catch block
d) set only
Ans:- 2)get and set
Q23.The optional parameter can be defined by using "?".
a) True
b) False
Ans:- 1)True
Q24.During compilation, TypeScript code gets converted to assembly language.
a) True
b) False
Ans:- 2)False
Q25.The following are ways to declare a variable in TypeScript, except ________.
a) var lengthB:string
b) var localLength=13
c) var lengthA:string = "meter"
d) var 2
Ans:- 4)var 2
Q26.TypeScript is an open source programming language.
a) True
b) False
Ans:- 1)True
