in TypeScript - JavaScript's Superset by
recategorized by
1) A JavaScript file cannot be renamed to a TypeScript file.

i) True

ii) False

Answer : False

2) TypeScript is a __________.

i) Dynamically type-checked language

ii) New version of JavaScript

iii) Compiler

iv) Super-set of JavaScript

Answer :Super-set of JavaScript

3) Typescript compiler tsc converts code to _________.

i) AngularJS

ii) JavaScript

iii) Machine Language

iv) Assembly Language

Answer: Machine Language

4) The value of TypeScript is writing _________.

i) Less code

ii) Safer code

5) TypeScript was made public by __________.

i)  Oracle

ii) Microsoft --

iii) ECMA

iv) Sun

Answer: ii) Microsoft

6) During run time, _______ checking is done.

i) Dynamic Type

ii) Static Type

Answer: Dynamic Type

7) Annotations can be implemented as __________.

i) length=12

ii) static length=12

iii) length: number

iv) var lengthC='1'

Answer: length: number

8) Which type is assigned to variables with null type?

i) any

ii) boolean

iii) None of the options

iv) string

Answer: None of the options

9) Type Annotations allow us to _______.

i) Reassign the type of data

ii) Record the intended contract of the function or variable  

iii) Cast to a supertype

iv) Cast a reference of a base class to one of its derived classes

Answer: Record the intended contract of the function or variable

10) A type system is a set of ________.

i) Predefined Functions

ii) Rules

iii) Data

iv) Variables

Answer: Rules

11) Static type checking is done at ________.

i) Compilation time

ii) Run time

Answer: Compilation time

12) Generics allows accepting arguments of _________.

i) Different types

ii) None of the options

iii) Only one type

Answer: i) Different types

13) Generics allows accepting arguments of _________.

i) Only one type

ii) None of the options

iii) Different types

Answer: iii) Different types

14) Which of the following is the right way of defining enum?

i) const enum DNA {}

ii) declare enum Enum {}

iii) enum Enum {}

iv) All the options

Answer: iv) All the options

15) Generics is a/an _______.

i) Template

ii) Object

iii) Functions

iv) Class

Answer: i) Template

16) " var jarvis = function (x: number, y?: number): number {} " showcases _________.

i) Both the options

ii) Defining Parameter

iii) Type annotation

Answer: i) Both the options

17) Inheritance is implemented by using the ________ keyword.

i) None of the options

ii) extends

iii) implements

iv) namespace

Answer: ii) extends

18) Syntax for a decorator is _________.

i) ?symbol{}

ii) @symbol

iii) #symbol

iv) *(symbol)

Answer: ii) @symbol

19) The following are correct ways of defining variables in TypeScript, except _________.

i) var DNA:string

ii) var NumberOfDNA=10231

iii) var 10231

iv) var DNA:string= "CGATAATCGGGGAATTTCAG"

Answer: iii) var 10231

20) value && typeof value == "DataType" is used for _________.

i) Inheritance

ii) Overriding

iii) Type annotation

iv) Overloading

Answer: iv) Overloading

21) Which of the options is used appropriately in JavaScript code?

i) function reverse(s: string) : string;

ii) function reverse (s: String) : String;

Answer: i) function reverse(s: string) : string;

22) TypeScript uses prototypical inheritance instead of classical inheritance.

i) False

ii) True

Answer: i) False

23) Which keyword is used to access base class properties?

i) extends

ii) implements

iii) super

iv) base

Answer: iv) base

24) The code snippet " if (value && typeof value == "string") {}; is used for ______________.

i) Parameterising

ii) Inheritance add-on

iii) Overriding

iv) Overloading

Answer: iv) Overloading

25) Which keyword is used for Inheritance in TypeScript?

i) implements

ii) defines

iii) extends

iv) follows

Answer: iii) extends

26) Which of the following is/are inherited from base class?

i) variables

ii) Both the options

iii) method

Answer: ii) Both the options

27) _________ in the command line enables experimental support for decorators.

i) "experimentalDecorators": true XXX

ii) "compilerOptions": {}

iii) "target": "ES5"

iv) " tsc –target ES5 –experimentalDecorators "

Answer: iv) " tsc –target ES5 –experimentalDecorators "

28) What is the form associated with @expression?

i) None of the options

ii) Decorators

iii) Module initialisation

iv) Constructors

Answer: ii) Decorators

29) The optional parameter can be defined by using "?".

i) False

ii) True

Answer: ii) True

Type System is a _____________.

i) Scripting Language

ii) Programming Language

iii) Compiler

iv) Set of rules

Answer: iv) Set of rules

30) The following are ways to declare a variable in TypeScript, except ________.

i) var 2

ii) var lengthB:string

iii) var localLength=13

iv) var lengthA:string = "meter"

Answer: i) var 2

31) Accessing a class of a module from outside is impossible in TypeScript.

i) False

ii) True

Answer: i) False

32) Decorators provide a way for ________________.

i) None of the options

ii) Both the options  

iii) Meta-programming syntax

iv) Annotation

Answer: ii) Both the options

33) What is true about Mixins in TypeScript?

i) Each class is focused on a particular activity

ii) All the options

iii) They are mixed together to form a new class

iv) They are partial classes

Answer: ii) All the options

34) Which of the following demonstrates function overloading, if possible, in TypeScript?

i) var a = function (n1: number, n3?: number) : number{}

ii) if (value && typeof value == "number"){}

iii) var f = 0;

iv) get len():string

Answer: ii) if (value && typeof value == "number"){}

The following types are supported by TypeScript, except

35) The following types are supported by TypeScript, except ______.

i) enum

ii) string

iii) boolean

iv) integer

Answer: iv) integer

36) Enum organizes a _______.

i) Set of un-related values

ii) Set of related values

Answer: ii) Set of related values

37) Generics allows accepting arguments of _________.

i) Different types

ii) None of the options

iii) Only one type

38) TypeScript is an open source programming language.

i) False

ii) True

Answer: ii) True

39) Contextual typing in TypeScript is a form of ___________.

i) Type Inference

ii) Inheritence

iii) Type Checking

iv) It does not exist

Answer: i) Type Inference

40) Why are optional parameters added?

i) To assure that value is always assigned to the variable

ii) To add more than three parameters  

iii) To avoid assigning value for parameterised variable  

iv) To avoid confusion

Answer: iii) To avoid assigning value for parameterised variable

41) During compilation, TypeScript code gets converted to assembly language.

i) False

ii) True

Answer: i) False

42) We can rename a .js file to .ts file generally.

i) False

ii) True

Answer : ii) True

Related questions

0 votes
asked Oct 30, 2019 by Robin
0 votes
asked Oct 30, 2019 by Robin
0 votes
asked Oct 30, 2019 by Robin
...