in JavaScript by
Q:
The following are correct ways of defining variables in TypeScript, except _________.

var DNA:string

var NumberOfDNA=10231

var 10231 ---

var DNA:string= "CGATAATCGGGGAATTTCAG"

1 Answer

0 votes
by
var 10231
Click here to read more about JavaScript
Click here to read more about Insurance

Related questions

0 votes
asked Jan 27, 2020 in JavaScript by AdilsonLima
0 votes
asked Feb 11, 2020 in HTML by rahuljain1
+1 vote
asked Apr 13, 2020 in QuickTest Professional (QTP) by rajeshsharma
0 votes
asked Jan 27, 2020 in JavaScript by AdilsonLima
+1 vote
0 votes
asked Oct 1, 2020 in PMP by SakshiSharma
...